| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.038276 |
| Chromosome: | chromosome 2 |
| Location: | 5192012 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g112100 | C1a-86,FAP101 | (1 of 31) IPR003590 - Leucine-rich repeat, ribonuclease inhibitor subtype; Flagellar Associated Protein 101 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGCTGCGGATTCAGCTGAGCCTGTGGAGCCAGCTTTACCACCCGCAA |
| Internal bar code: | GATACTGCTGTAGTTTACGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 395 |
| LEAP-Seq percent confirming: | 28.5714 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTCCGTGTTCTTGAGACA |
| Suggested primer 2: | ATGCATAAAGACGGTGGGCA |