| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.038287 |
| Chromosome: | chromosome 16 |
| Location: | 4911206 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686800 | PTA2 | (1 of 10) IPR005828//IPR020846 - Major facilitator, sugar transporter-like // Major facilitator superfamily domain; Proton/phosphate symporter, splice variant b | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTCGTGTGGGACTTCGCCTTCTACGTGAGTCGTGCGGCGGATGGGGG |
| Internal bar code: | TGCATGCTATGGTTAGCGATAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4599 |
| LEAP-Seq percent confirming: | 96.1538 |
| LEAP-Seq n confirming: | 75 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGCATGCATCCCGAAACT |
| Suggested primer 2: | CAGAGTCGTTCCAACACCGA |