Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.038297 |
Chromosome: | chromosome 2 |
Location: | 1095608 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g080550 | PDE26 | (1 of 1) PF00012//PF00233 - Hsp70 protein (HSP70) // 3'5'-cyclic nucleotide phosphodiesterase (PDEase_I); 3'%252C5'-cyclic-nucleotide phosphodiesterase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCACCACCGCCCGCACCGCAGCCGGCAGCGGCGCCGGCGGCGCCAGGC |
Internal bar code: | CGGTGCTCTACATATTAGATTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1755 |
LEAP-Seq percent confirming: | 60.0 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACGGTATCGGTGCTCTACC |
Suggested primer 2: | ATGCACACACACACACATGC |