Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.038436 |
Chromosome: | chromosome 16 |
Location: | 4598904 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g671000 | NDA5 | Type-II NADH dehydrogenase; (1 of 1) K17872 - NADH:ubiquinone reductase (non-electrogenic) (ndh2) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTTCCACGCACGCCGCTTCCGTCTGCACCACTTCCCTCTCCCTCTCCC |
Internal bar code: | AAGAGTTTGTGTTTATTACAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 811 |
LEAP-Seq percent confirming: | 93.3333 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCCACCCAACCCCTGATC |
Suggested primer 2: | GGATTGGTGACGGTAGGCAA |