| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.038440 |
| Chromosome: | chromosome 3 |
| Location: | 4887729 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g178550 | (1 of 1) K10260 - F-box and WD-40 domain protein 7 (FBXW7, SEL10) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGACGCCAAACTATGCGCTACGTACAGCAATCCAGGTGCGCGGTAGGG |
| Internal bar code: | ATAGCTAAGTGAGTGTCGCTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 955 |
| LEAP-Seq percent confirming: | 63.8298 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTGGTCCTCCATCACCTG |
| Suggested primer 2: | ATAACGGGAAAGGGCCCTTG |