Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.038448 |
Chromosome: | chromosome 16 |
Location: | 2122249 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g657850 | SEC63 | (1 of 1) K09540 - translocation protein SEC63 (SEC63, DNAJC23); ER-targeted preprotein translocase subunit | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACACAGGCAGGGATTGGTGGCGACACAACAGGTCAGCCCACAGCACCAC |
Internal bar code: | GTAGAAGTTTATGTGTTAGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 529 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGTGTTTCCTCCTCTGCC |
Suggested primer 2: | ACACACACAAACACACACGC |