| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.038483 |
| Chromosome: | chromosome 2 |
| Location: | 1090264 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g080550 | PDE26 | (1 of 1) PF00012//PF00233 - Hsp70 protein (HSP70) // 3'5'-cyclic nucleotide phosphodiesterase (PDEase_I); 3'%252C5'-cyclic-nucleotide phosphodiesterase | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTTCACCACGTGCGCCGACGACCAGCGGGATGTGGTCATAGAGGTGCG |
| Internal bar code: | CGCCATGGGGGCCGCAAGACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4297 |
| LEAP-Seq percent confirming: | 87.6712 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCCATCCTCTGATCCTCAC |
| Suggested primer 2: | TTGGATGTTCGGCCCTTACC |