| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.038496 |
| Chromosome: | chromosome 10 |
| Location: | 4453324 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g450700 | CSB329,TNP26 | (1 of 70) PF07282 - Putative transposase DNA-binding domain (OrfB_Zn_ribbon); {"Probable transposon-derived protein of Chlamydomonas-Specific family B | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCTACAACTGCGGGTGTCAGGAGATGGCCATCAAGCGGCTTGGGGGG |
| Internal bar code: | GGGTTAATCTCAAAAAATCTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5100 |
| LEAP-Seq percent confirming: | 84.0 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTGCCAAACGGTGAGACC |
| Suggested primer 2: | GGGCCGATTCCATATGAGCA |