| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.038574 |
| Chromosome: | chromosome 2 |
| Location: | 2572298 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g092750 | RRM3,SSA18 | Putative ribosomal RNA methyltransferase; (1 of 1) 2.1.1.296//2.1.1.57 - Methyltransferase cap2 / mRNA (nucleoside-2'-O)-methyltransferase // Methyltransferase cap1 / mRNA (nucleoside-2'-O)-methyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGCACGCAAGACCTGGCGCGACGGCAGATTCAGGCCTGCGAGGCGGCT |
| Internal bar code: | GGAATTATTAGAGGCTACAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1767 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTATCTCCCCTGCTGCAAC |
| Suggested primer 2: | GCCTTGGTTTTGCGTCATGT |