Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.038697 |
Chromosome: | chromosome 14 |
Location: | 3832223 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g632450 | (1 of 2) PTHR21131:SF0 - SEMINAL FLUID PROTEIN 33A3 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCACACGCGCCTGCTCGATCGCCTTTCCTCCCCCGCACGCTCACGTGCA |
Internal bar code: | AAGCTAACAAGGTCTGCTTGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2548 |
LEAP-Seq percent confirming: | 71.2766 |
LEAP-Seq n confirming: | 67 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 94 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAGGACAGCAGTTACCGTT |
Suggested primer 2: | TGATGAACCTGTCCCACGTG |