Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.038837 |
Chromosome: | chromosome 6 |
Location: | 4913776 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g280850 | PBG1 | 20S proteasome beta subunit, type 4; (1 of 1) K02736 - 20S proteasome subunit beta 7 (PSMB4) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGAAGTGTGGTGATGTGGACGCCCGCCGTCAAAACGTCCGCATCCGT |
Internal bar code: | CCGCATTATGGAGGTGTGTTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 495 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGATGACATGAGCGAGGAGG |
Suggested primer 2: | TTGTCCTCTTCACCGCACTC |