| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.038839 |
| Chromosome: | chromosome 7 |
| Location: | 1012669 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g319600 | FAE3 | (1 of 3) K15397 - 3-ketoacyl-CoA synthase (KCS); Putative 3-keto-acyl-CoA synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCCACGCACAGGCCCTTCGCGACATTCACGAGGTGCATGACGCCTGGG |
| Internal bar code: | TAGGGAAAGGGATCGCGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3192 |
| LEAP-Seq percent confirming: | 72.7273 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCTTCCCCTCATCTCTCC |
| Suggested primer 2: | TGGTATGCACTTGCTCACGT |