Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.038868 |
Chromosome: | chromosome 8 |
Location: | 3571080 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g379450 | (1 of 1) K01190 - beta-galactosidase (lacZ) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCGCATTCCTCACGCTCCGGGCGCCCGGCCAGGCGATAGCACCACAC |
Internal bar code: | ATGAGCCCCAATTTCCGCTTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 588 |
LEAP-Seq percent confirming: | 68.1818 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCTGCACTCGACCAGTTT |
Suggested primer 2: | TATGCATGGGAGCGCACTAG |