Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.038906 |
Chromosome: | chromosome 10 |
Location: | 4656425 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g451850 | KATL2 | (1 of 4) K07767 - katanin p60 ATPase-containing subunit A1 [EC:3.6.4.3] (KATNA1); Katanin like protein 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGAGGGGCGACGGTCAATGCCCAAGCCCAAGGGATAGGCCCCGTCATC |
Internal bar code: | GACGACCAGCACAAAGAAGGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4629 |
LEAP-Seq percent confirming: | 78.3626 |
LEAP-Seq n confirming: | 134 |
LEAP-Seq n nonconfirming: | 37 |
LEAP-Seq n unique pos: | 171 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGCTGTCAACCCTGTTTG |
Suggested primer 2: | CACAGAAAGCACAAAGGGCC |