| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.038921 |
| Chromosome: | chromosome 11 |
| Location: | 1483910 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g469224 | (1 of 1) IPR010036//IPR023214 - Magnesium-dependent phosphatase-1, eukaryotic/arcaheal type // HAD-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGGCCCGCATCCCACAGCACACACACACACACACACACACACACACA |
| Internal bar code: | TTTCGTGCTAAGCTACTGTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3377 |
| LEAP-Seq percent confirming: | 84.2105 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGTAACAGCCGGTTTGCG |
| Suggested primer 2: | GGCTGCCTCATCACCTTCTT |