| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.038949 |
| Chromosome: | chromosome 6 |
| Location: | 8681827 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g310100 | (1 of 6) IPR000719//IPR001245//IPR002290//IPR011009//IPR020635//IPR029016 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain // GAF domain-like | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCCCGCTGCAGAATGCGCTCCACGGACGCATTTGATCCCGGCACTTTA |
| Internal bar code: | AGGAAGAGCAGATTATTAGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2154 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGCCACTCTATGCTGCTC |
| Suggested primer 2: | CTGGGTCAGGTCGTCGAAAA |