Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.039003 |
Chromosome: | chromosome 10 |
Location: | 2628384 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g437050 | ATP11 | (1 of 1) K07555 - ATP synthase mitochondrial F1 complex assembly factor 1 (ATPeAF1, ATPAF1, ATP11); Assembly factor 1 for F1 component of mitochondrial ATP synthase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCCAGATGTCCGCCACCTCGTCCCGGTCCTTCTTGATCAGCTCATCCA |
Internal bar code: | CAGGAGTACATGCGTACTAGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1661 |
LEAP-Seq percent confirming: | 64.2857 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGTGCCTTTGATACCGCG |
Suggested primer 2: | CTCAAGGCCTGTGATGAGCA |