| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.039060 |
| Chromosome: | chromosome 13 |
| Location: | 4148177 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g591300 | (1 of 18) PTHR19862:SF14 - WD REPEAT-CONTAINING PROTEIN 48 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCCCCGTGCGTCACACGCGCATGCCACCCTCCACCCCCGCAGGCCGC |
| Internal bar code: | ACAGGAAGTCTACCCCATTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1740 |
| LEAP-Seq percent confirming: | 78.2609 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGGGTGTTAGGAGGGACG |
| Suggested primer 2: | CAAGGCAAAGACACAGACGC |