| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.039083 |
| Chromosome: | chromosome 16 |
| Location: | 6357401 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g675650 | ALDH6,ALD8,ALDH6B1 | (1 of 1) 1.2.1.27 - Methylmalonate-semialdehyde dehydrogenase (CoA acylating) / MSDH; Aldehyde dehydrogenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACCAGCAGTATCACCAGCACCGGGGCGTCCCTCCCATTCCACCCTTCC |
| Internal bar code: | CGGGAGATCGTTGGGGTGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1316 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGATGATCAGTCCCGAGGTG |
| Suggested primer 2: | TTGATGCCCACCATACCCAC |