Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.039138 |
Chromosome: | chromosome 17 |
Location: | 3281077 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g722000 | MFT30,SOC1 | Major facilitator superfamily transporter; (1 of 1) K08214 - MFS transporter, OCT family, solute carrier family 22 (organic cation transporter), member 18 (SLC22A18) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGAACGCGGTCTGGAGGCGCGCATACTGCATGCTCCCGGAAGCGCCCAG |
Internal bar code: | AAGGGACCATTTACGAAATCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2236 |
LEAP-Seq percent confirming: | 31.5789 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACCGGTGTCAGCAAGTTG |
Suggested primer 2: | CACTCGCCATGCCAAAACAA |