| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.039145 |
| Chromosome: | chromosome 17 |
| Location: | 5792973 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g741250 | PHR1,PHR6 | (1 of 1) 2.5.1.77 - 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase; 7%252C8-didemethyl-8-hydroxy-5-deazariboflavin synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGTAAACACAAACAAACACGCCCGCTCGCCTCTGTGGCGCCTCGCTCC |
| Internal bar code: | GTTGTCCACCCATTAGTAATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4047 |
| LEAP-Seq percent confirming: | 89.7436 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGGCTCGTCCCCTAATCT |
| Suggested primer 2: | CTCCTGTCGACACACACACA |