| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.039230 |
| Chromosome: | chromosome 5 |
| Location: | 1574896 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234700 | PYK3 | Pyruvate kinase 3; (1 of 2) PTHR11817:SF3 - PYRUVATE KINASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCCCCCGTGTGCCTCAACCCGCACGCCCCCACGCCGCGCATCCAGGC |
| Internal bar code: | TGCTTTTGCCGCTTTGAATGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2873 |
| LEAP-Seq percent confirming: | 88.8889 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCTGGAGGAGGAGGATGT |
| Suggested primer 2: | CACAGCGCTCACGTTTTTGA |