Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.039292 |
Chromosome: | chromosome 16 |
Location: | 1796622 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g655200 | PTB6 | Sodium/phosphate symporter PTB6b; (1 of 9) K14640 - solute carrier family 20 (sodium-dependent phosphate transporter) (SLC20A, PIT) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACACGAAACAAGCCGAGTAGTGTTAGGAAAGCAAGCTACCGTGGGCTT |
Internal bar code: | GCTTTTACTTTACATACTTTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1619 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTTTCGGAACCAGTGTCGG |
Suggested primer 2: | GATGTATCAGTGCGCGAGGA |