| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.039318 |
| Chromosome: | chromosome 1 |
| Location: | 4465208 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g030550 | UBX1 | (1 of 1) PTHR13020:SF34 - UBX DOMAIN-CONTAINING PROTEIN 4; possible ubiquitin-proteasome pathway protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATACAAAACCAAAAGCCATAACGCCATTCGCGCGGCGATGCCAACAAAG |
| Internal bar code: | GATCAGCGTTAACGTGTCGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1904 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 44 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGATGGTAGCATCGGCAT |
| Suggested primer 2: | CACCCGATCGCAAATTCGTC |