Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.039325 |
Chromosome: | chromosome 5 |
Location: | 2726446 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g240500 | (1 of 1) PTHR24375:SF140 - ZINC FINGER WITH UFM1-SPECIFIC PEPTIDASE DOMAIN PROTEIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCGTGCCACTCCGTTGTCAAGCATCGGCCACGCTCTCCTCCTCGCTCT |
Internal bar code: | CGCTGGGGTTAGGGCTTGCTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2641 |
LEAP-Seq percent confirming: | 97.8261 |
LEAP-Seq n confirming: | 45 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGCCGAGGCTTAAAACGAA |
Suggested primer 2: | GACAGGACGCGGTAGATGAG |