Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.039329 |
Chromosome: | chromosome 16 |
Location: | 221293 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g694700 | (1 of 274) IPR020683 - Ankyrin repeat-containing domain | CDS | |
Cre16.g694750 | GT90F30,GT90-30 | GT90 family protein 30; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCGCTCCCGAACTGGCGTGCACACCTCGCAGCCCTGCAATCCCCAGC |
Internal bar code: | ACCTTTTTGGAAGTTGGAAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1005 |
LEAP-Seq percent confirming: | 91.6667 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTATCCTCATGCCCAGCT |
Suggested primer 2: | TGAGACGAGAGGAAGGAGGG |