| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.039343 |
| Chromosome: | chromosome 4 |
| Location: | 3178259 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g226150 | AOC1 | (1 of 4) PTHR11785:SF367 - AMINO-ACID PERMEASE BAT1; Amino acid carrier | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACACAGCAGCCGCCCCTCACCCACCGTAGCTGAGGCTCAGCGCCACCA |
| Internal bar code: | GGTGCTGCAATCAAGCAAATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1264 |
| LEAP-Seq percent confirming: | 40.5405 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTGCTCTCTCCCTCTCTC |
| Suggested primer 2: | TTATCTGCACCACCACCACC |