| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.039419 |
| Chromosome: | chromosome 12 |
| Location: | 3836197 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g514950 | CGLD17,HEL53 | (1 of 1) PTHR12873//PTHR12873:SF0 - T7-LIKE MITOCHONDRIAL DNA HELICASE // TWINKLE PROTEIN, MITOCHONDRIAL; Conserved in the Green Lineage and Diatoms | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCTGGAACCGCCCACATGCCCCCTCACCATCACCACCACCGCCCCCTG |
| Internal bar code: | ATTGACCGCCGGGAGTGAGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 509 |
| LEAP-Seq percent confirming: | 21.2121 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTTCGTTCGGGTTTGGA |
| Suggested primer 2: | CATTGCTATCCACGCACAGC |