| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.039420 |
| Chromosome: | chromosome 9 |
| Location: | 5404066 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g408350 | DeSI-5,DESI5 | DeSI-type SUMO protease; (1 of 15) 3.4.21.72 - IgA-specific serine endopeptidase / Immunoglobulin A1 protease | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTCTTCCATCTTCTCCTGCAACACAACAAAAATGCGGTCCAAACACTG |
| Internal bar code: | AATGACAGTCACTTGGTGTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5385 |
| LEAP-Seq percent confirming: | 97.8723 |
| LEAP-Seq n confirming: | 92 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 94 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGATAGGCACCTGGTTTGGC |
| Suggested primer 2: | AAGTCTACCACCAGCGGTTG |