Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.039455 |
Chromosome: | chromosome 11 |
Location: | 2862998 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095045 | (1 of 1) PF00628//PF13871//PF13872 - PHD-finger (PHD) // C-terminal domain on Strawberry notch homologue (Helicase_C_4) // P-loop containing NTP hydrolase pore-1 (AAA_34) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTAGGGCATGGGCATTTGATGGTGTGATGCAGTGGCGAGCAGGTTGCTT |
Internal bar code: | TACAGGTCTACTGAGTTGGTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 6361 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 52 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGTCGGCGTTTGTCATCT |
Suggested primer 2: | CACAATGGCCTCGTCGTAGT |