Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.039515 |
Chromosome: | chromosome 2 |
Location: | 5779161 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g116900 | SETB,HDP1 | Homolog of small hydrophilic plant seed proteins; (1 of 1) PTHR34671:SF1 - EM-LIKE PROTEIN GEA6 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACACCTGGTATCCCTCGTGGCCCAGCTGCTCCTTCCTGCGCCCAGATC |
Internal bar code: | ACAACGTTGATATTCATACTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1104 |
LEAP-Seq percent confirming: | 38.7097 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCATCCCAAAACCCATCA |
Suggested primer 2: | ACCTCATTTGCAGCTCGGAA |