Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.039570 |
Chromosome: | chromosome 9 |
Location: | 2227620 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g395100 | MKP4 | (1 of 3) K14165 - atypical dual specificity phosphatase [EC:3.1.3.16 3.1.3.48] (K14165); Dual-specificity protein phosphatase | intron |
Cre09.g801012 | (1 of 781) IPR000104 - Antifreeze protein, type I | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGACACGCGGCGTCAGGCGTAAGCGGGACGCAGATTAACGTCACTGTG |
Internal bar code: | CCGCATCGGCAAAGCGGTCGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1071 |
LEAP-Seq percent confirming: | 3.44828 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 28 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGACCAGGATTCTACTCGCG |
Suggested primer 2: | CTCCTAAAGACGGGAGGGGA |