| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.039607 |
| Chromosome: | chromosome 17 |
| Location: | 3712138 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g726000 | PAP3 | Class-II RNA nucleotidyl transferase 3, mitochondrial; (1 of 2) 2.7.7.72 - CCA tRNA nucleotidyltransferase / tRNA-nucleotidyltransferase | intron |
| Cre17.g726050 | Similar to Ubiquitin-Specific Protease; (1 of 1) K11843 - ubiquitin carboxyl-terminal hydrolase 14 [EC:3.4.19.12] (USP14, UBP6) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGACCACACACTCGGGGTGCACTCCAAGTCAACGCACACACACATACA |
| Internal bar code: | TGATCGGAATCGAATCTGCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3344 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCGCATGCCATATGGAAG |
| Suggested primer 2: | GTGTCCGCCAACTCTTCTCA |