Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.039612 |
Chromosome: | chromosome 4 |
Location: | 1692350 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g212400 | UBC15 | (1 of 10) IPR001876 - Zinc finger, RanBP2-type | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACTTTAGACCAAAGCGCCACCATGCGCAACGACGCAAAACAACGCAAC |
Internal bar code: | ATTAGCTACTTGGGCGTGGGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2496 |
LEAP-Seq percent confirming: | 95.4545 |
LEAP-Seq n confirming: | 42 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCTGGGTCCTCTTCGATCT |
Suggested primer 2: | GATCACTCTGATGGAGGGCG |