Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.039695 |
Chromosome: | chromosome 16 |
Location: | 7471929 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g681802 | (1 of 2) PF00069//PF01590//PF07714 - Protein kinase domain (Pkinase) // GAF domain (GAF) // Protein tyrosine kinase (Pkinase_Tyr) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGTATCCCTGGACACCACCACAAACAAGGAACACCTCCCACCCAGCGC |
Internal bar code: | CTGAATACCATACCGTCAGCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1707 |
LEAP-Seq percent confirming: | 73.6842 |
LEAP-Seq n confirming: | 28 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGACACTACTGGCACGTGT |
Suggested primer 2: | CCCACAACCAGACCCAGATC |