Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.039715 |
Chromosome: | chromosome 13 |
Location: | 2553935 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g580300 | CGLD4,ABC3 | Conserved in the Green Lineage and Diatoms; (1 of 1) PTHR12847//PTHR12847:SF6 - ATP-BINDING CASSETTE ABC TRANSPORTER-RELATED // ABC TRANSPORTER I FAMILY MEMBER 19-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCGTCCGACGCATTGAGTTTACAGCATGGTAACCTGCAAGGCGCCCCC |
Internal bar code: | GGGTTACTCACTCCCACATAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4194 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 80 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 80 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACGCTACTGCAAATCGTCG |
Suggested primer 2: | GTACACACACACGCACACAC |