Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.039820 |
Chromosome: | chromosome 16 |
Location: | 6544234 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g674450 | (1 of 4) PTHR11266//PTHR11266:SF42 - PEROXISOMAL MEMBRANE PROTEIN 2, PXMP2 MPV17 // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAACCCACCGCTACCCGCCTGCTGCAGCTGTTCTGGAGCGCCGTTATGT |
Internal bar code: | ATGTAGGACGGGCTAAGATAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 686 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTTCTCTCCACATGCCTT |
Suggested primer 2: | ACAAGTACAACAACACGCGC |