| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.039922 |
| Chromosome: | chromosome 14 |
| Location: | 277249 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g609400 | (1 of 6) 1.8.4.11 - Peptide-methionine (S)-S-oxide reductase / Peptide methionine sulfoxide reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCTGCTCTGCTCTGCGCTGGCGGCTGCTGCCTTCCCGCGCGCTTGCTA |
| Internal bar code: | ATCAGTACGAATTCTTGTAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 596 |
| LEAP-Seq percent confirming: | 77.7778 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCGCTTTCGAATCGACTC |
| Suggested primer 2: | CGGCTTAGTTTGGGCTGGTA |