Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.039939 |
Chromosome: | chromosome 9 |
Location: | 2270260 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g394800 | MITC16, MCP16 | Mitochondrial substrate carrier protein; (1 of 3) K05863 - solute carrier family 25 (mitochondrial adenine nucleotide translocator), member 4/5/6/31 (SLC25A4S, ANT) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTAACCGCCTGCCGCTCGACTGCCCTTTGGCTCGCAGGCCCCTTGCTAT |
Internal bar code: | CGGTCGAGTAGGAAGTCTTAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2223 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 97 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 97 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACACGGAAAAAGGTGTGGC |
Suggested primer 2: | CAACGACGGACTTGGAGGAA |