Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.039954 |
Chromosome: | chromosome 12 |
Location: | 1752073 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g486050 | (1 of 1) PF00098//PF00397 - Zinc knuckle (zf-CCHC) // WW domain (WW) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATTCCTTCGCCACATCGGGCTCCACCGCCCCTCACCCCACCCCACCT |
Internal bar code: | TAAGCGAGTTGTCGCTCTGAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 160 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTCAGGCGAACCCAAGAGA |
Suggested primer 2: | AGCGTCGCCGTCTAAGTATG |