| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.040008 |
| Chromosome: | chromosome 12 |
| Location: | 9355946 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g541750 | ZPD1 | (1 of 1) 1.3.99.30 - Phytoene desaturase (3,4-didehydrolycopene-forming) / 5-step phytoene desaturase; Putative zeta-phytoene desaturase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTCACCAGCGCAACTGGATGTTGCGGCGGTGTCTCCTGCAGCGGTCTT |
| Internal bar code: | GGATTTTTATTGTGGCTGCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 725 |
| LEAP-Seq percent confirming: | 21.4286 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGAGCCGAGCTAGACATG |
| Suggested primer 2: | GGTTCAAGGAAGTCCAGCGA |