| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.040033 |
| Chromosome: | chromosome 1 |
| Location: | 4610038 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g031850 | ACD1 | (1 of 1) PTHR10314//PTHR10314:SF70 - SER/THR DEHYDRATASE, TRP SYNTHASE // SUBFAMILY NOT NAMED; 1-aminocyclopropane-1-carboxylate deaminase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGGACTTCTTCCCCCCTGTCTCTCTCACACACACGCACACACGCACGC |
| Internal bar code: | ACTCTGCATATGGTTGGTGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3040 |
| LEAP-Seq percent confirming: | 90.2439 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCACACAATCCCTCATGA |
| Suggested primer 2: | CAACTTTGCGCTCGTTGACA |