| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.040105 |
| Chromosome: | chromosome 2 |
| Location: | 7791174 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g146500 | DSK1,DYRK1 | Dual-specificity tyrosine regulated protein kinase; (1 of 1) K18669 - dual specificity tyrosine-phosphorylation-regulated kinase 2/3/4 (DYRK2_3_4) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCAGGCTTGCCTGTGCGACGTGAGCCACTGACGGCACCGATGCCGCCT |
| Internal bar code: | TCATCTTTCTGTCTGATTGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 234 |
| LEAP-Seq percent confirming: | 16.6667 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTTGCTGGAGAAGTGCCT |
| Suggested primer 2: | TGCCAATGCTGCTTTGCAAA |