| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.040138 |
| Chromosome: | chromosome 16 |
| Location: | 4465874 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g667900 | (1 of 11) IPR001471//IPR016177//IPR031112 - AP2/ERF domain // DNA-binding domain // AP2-like ethylene-responsive transcription factor; ANT-subfamily ortholog | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGCGTCGCCCTCGCTGCCACCAGCACCGCCGGCACTGCCGCCGCCGCC |
| Internal bar code: | ATGGTCTCTCGGTCCGTTTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 262 |
| LEAP-Seq percent confirming: | 28.5714 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCGCTGGTTGTGACTGTCA |
| Suggested primer 2: | CCGCCAACCAGCATTGAATC |