| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.040156 |
| Chromosome: | chromosome 13 |
| Location: | 1478105 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g572350 | HSP22G | Heat shock protein 22G; (1 of 1) PTHR11527//PTHR11527:SF110 - SMALL HEAT-SHOCK PROTEIN HSP20 FAMILY // 17.4 KDA CLASS I HEAT SHOCK PROTEIN-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAAACCATCACGCACGCGCACACACACACGCACACACAGACACACGCA |
| Internal bar code: | GTTAGGGCGCCGCGTCACGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 190 |
| LEAP-Seq percent confirming: | 11.1111 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCGTGCATAGCCAACAAG |
| Suggested primer 2: | CCAAACTAACGTTGGCGCAA |