Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.040166 |
Chromosome: | chromosome 16 |
Location: | 527064 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g692600 | ULP2,SMT7,SENP1 | ULP2-type SUMO protease; (1 of 2) K08592 - sentrin-specific protease 1 [EC:3.4.22.68] (SENP1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGCGGCAGAGGTGGCGGCGGCAAGTGTTGGAACGGAACCAATACGGGG |
Internal bar code: | GCCGCGGATCGTGTCTCCTTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 121 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCGTCGTTGCAGTCCTTAT |
Suggested primer 2: | ACACATACCTCGCAAGCACA |