| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.040170 |
| Chromosome: | chromosome 11 |
| Location: | 2473882 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095113 | DIV24,TFCE1,TFC-E | Tubulin-folding cofactor subunit; (1 of 1) IPR000938//IPR029071 - CAP Gly-rich domain // Ubiquitin-related domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAACATCCGTAAACCGTCGCTTTGCTGCATCGCATACACTGTCTTTGCG |
| Internal bar code: | AGTACATACAGGAACCATCACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4580 |
| LEAP-Seq percent confirming: | 95.6044 |
| LEAP-Seq n confirming: | 87 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 91 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCAACCCCTTCTGTCTCGC |
| Suggested primer 2: | GCTTGCTTTGCGTTCTGGAA |