Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.040298 |
Chromosome: | chromosome 3 |
Location: | 2579670 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g160100 | (1 of 1) K06889 - uncharacterized protein (K06889) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTTGCTTTCATGTCTGAGCGCACGACTTGGTGTACCCGCGTGACCTCG |
Internal bar code: | GGGCGTTAGGTTTGGTGGGCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2422 |
LEAP-Seq percent confirming: | 98.0392 |
LEAP-Seq n confirming: | 50 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCAGGCACAAAAGGACTTG |
Suggested primer 2: | TTCGTCGTCCAAATCAGCCA |