| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.040323 |
| Chromosome: | chromosome 3 |
| Location: | 4450354 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g175550 | (1 of 38) IPR002048//IPR011992 - EF-hand domain // EF-hand domain pair | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGACAGCCCCAGCGCCGCCGCCGCCACCTCCGCCAGCTCCACACCGTA |
| Internal bar code: | GTAGATCTAAAGTGGTGATTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1734 |
| LEAP-Seq percent confirming: | 20.8333 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGTAGTATCACAACGCGG |
| Suggested primer 2: | CTCCTACTCTTGGCGCTGAC |