| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.040327 |
| Chromosome: | chromosome 11 |
| Location: | 4127451 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g481200 | PHX17,PFH6,P4H6 | Prolyl 4-hydroxylase 6; (1 of 5) PTHR10869:SF55 - OXOGLUTARATE/IRON-DEPENDENT OXYGENASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCATTTGGAACGATGTGTACCAGAAGAAATCAATCTTCGTGCCCACCT |
| Internal bar code: | GGTGGCCCGCTTATAGTTCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 160 |
| LEAP-Seq percent confirming: | 27.2727 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAACCACCAGAGCGTGAACC |
| Suggested primer 2: | CGGCTAGATGACATCCGGAC |